pwzlblast gfp (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
pwzlblast gfp
Pwzlblast Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pwzlblast+gfp/pWZL+Blast+GFP+(Plasmid+%2312269)/pmc05190085-230-11-14
Average 93 stars, based on 33 article reviews
Pwzlblast Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pwzlblast+gfp/pWZL+Blast+GFP+(Plasmid+%2312269)/pmc05190085-230-11-14
Average 93 stars, based on 33 article reviews
pwzlblast gfp - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Stable Transfection:Article Title: Epithelial-to-Mesenchymal Transition Rewires the Molecular Path to PI3K-Dependent Proliferation Article Snippet: For stable cell line generation, pWZL-Blast-TwistER (Addgene plasmid 18799), pWZL-Blast-SnailER (Addgene plasmid 18798), or pWZLBlast-GFP (Addgene plasmid 12269) vectors were obtained from Addgene and have been previously described ( 38, 39 ). Article Title: Epithelial-to-Mesenchymal Transition Rewires the Molecular Path to PI3K-Dependent Proliferation Article Snippet: 2014;4:186-199.. Published OnlineFirst December 3, 2013.Cancer Discovery Megan B.. Salt, Sourav Bandyopadhyay and Frank McCormick PI3K-Dependent Proliferation Epithelial-to-Mesenchymal Transition Rewires the Molecular Path to Updated version 10.1158/2159-8290.CD-13-0520doi: Access the most recent version of this article at: Material Supplementary http://cancerdiscovery.aacrjournals.org/content/suppl/2013/12/03/2159-8290.CD-13-0520.DC1.html Access the most recent supplemental material at: Cited Articles http://cancerdiscovery.aacrjournals.org/content/4/2/186.full.html#ref-list-1 This article cites by 39 articles, 10 of which you can access for free at: Citing articles http://cancerdiscovery.aacrjournals.org/content/4/2/186.full.html#related-urls This article has been cited by 1 HighWire-hosted articles. Plasmid Preparation:Article Title: Epithelial-to-Mesenchymal Transition Rewires the Molecular Path to PI3K-Dependent Proliferation Article Snippet: For stable cell line generation, pWZL-Blast-TwistER (Addgene plasmid 18799), pWZL-Blast-SnailER (Addgene plasmid 18798), or pWZLBlast-GFP (Addgene plasmid 12269) vectors were obtained from Addgene and have been previously described ( 38, 39 ). Article Title: Epithelial-to-Mesenchymal Transition Rewires the Molecular Path to PI3K-Dependent Proliferation Article Snippet: 2014;4:186-199.. Published OnlineFirst December 3, 2013.Cancer Discovery Megan B.. Salt, Sourav Bandyopadhyay and Frank McCormick PI3K-Dependent Proliferation Epithelial-to-Mesenchymal Transition Rewires the Molecular Path to Updated version 10.1158/2159-8290.CD-13-0520doi: Access the most recent version of this article at: Material Supplementary http://cancerdiscovery.aacrjournals.org/content/suppl/2013/12/03/2159-8290.CD-13-0520.DC1.html Access the most recent supplemental material at: Cited Articles http://cancerdiscovery.aacrjournals.org/content/4/2/186.full.html#ref-list-1 This article cites by 39 articles, 10 of which you can access for free at: Citing articles http://cancerdiscovery.aacrjournals.org/content/4/2/186.full.html#related-urls This article has been cited by 1 HighWire-hosted articles. other:Article Title: Mitochondrial clearance by the STK38 kinase supports oncogenic Ras-induced cell transformation Article Snippet: To generate the pSuper.retro.puro_shSTK38-2 vector expressing shRNAs against human STK38, the following oligonucleotide pairs were inserted into pSuper.retro.puro (Oligoengine) using BglII and HindIII : 5′-GATCCCCGTCGGCCATAAACAGCTATTCAAGAGATAGCTGTTTATGGCCGACGTTTTTGGAAA-3′ and 5′- AGCTTTTCCAAAAACGTCGGCCATAAACAGCTATCTCTTGAATAGCTGTTTATGGCCGACGGG-3′ targeting the 3′UTR of STK38. |